NCERT Solutions for Class 12 Biology

NCERT Solutions for Class 12 Biology in PDF form to free download updated for new academic session 2020-21 for UP Board, CBSE, MP Board and all other boards who are following CBSE Syllabus 2020-2021.

All the NCERT solutions 2020-21 and NCERT books are given to download chapter wise. Download Supplementary material for class 12 Biology in PDF form. Join the Discussion forum and ask your doubts.

NCERT Solutions for Class 12 Biology

Class:12
Subject:Biology
Contents:NCERT Solutions

NCERT Solutions for Class 12 Biology in English

NCERT Solutions for Class 12 Biology all chapters are given below. NCERT Solutions 2020-21 for other subjects Physics, Chemistry, Maths are also available to download. Download sample papers and Previous Years CBSE board papers as per latest CBSE Syllabus for 2020-2021 for more practice of subjects. Download all chapters in PDF format available in NCERT solutions sections of each subject.

Main Points for Chapter 1, 2, 3

Chapter-1: Reproduction in Organisms
Reproduction, a characteristic feature of all organisms for continuation of species; modes of reproduction – asexual and sexual reproduction; asexual reproduction – binary fission, sporulation, budding, gemmule formation, fragmentation; vegetative propagation in plants.

Chapter-2: Sexual Reproduction in Flowering Plants
Flower structure; development of male and female gametophytes; pollination – types, agencies and examples; outbreeding devices; pollen-pistil interaction; double fertilization; post fertilization events – development of endosperm and embryo, development of seed and formation of fruit; special modes-apomixis, parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.

Chapter-3: Human Reproduction
Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis – spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development upto blastocyst formation, implantation; pregnancy and placenta formation (elementary idea); parturition (elementary idea); lactation (elementary idea).

Main Points for Chapter 4, 5, 6

Chapter-4: Reproductive Health
Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth control – need and methods, contraception and medical termination of pregnancy (MTP); amniocentesis; infertility and assisted reproductive technologies – IVF, ZIFT, GIFT (elementary idea for general awareness).

Chapter-5: Principles of Inheritance and Variation
Heredity and variation: Mendelian inheritance; deviations from Mendelism – incomplete dominance, co-dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic inheritance; chromosome theory of inheritance; chromosomes and genes; Sex determination – in humans, birds and honey bee; linkage and crossing over; sex linked inheritance – haemophilia, colour blindness; Mendelian disorders in humans – thalassemia; chromosomal disorders in humans; Down’s syndrome, Turner’s and Klinefelter’s syndromes.

Chapter-6: Molecular Basis of Inheritance
Search for genetic material and DNA as genetic material; Structure of DNA and RNA; DNA packaging; DNA replication; Central dogma; transcription, genetic code, translation; gene expression and regulation – lac operon; genome and human and rice genome projects; DNA fingerprinting.

Main Points for Chapter 7, 8, 9

Chapter-7: Evolution
Origin of life; biological evolution and evidences for biological evolution (paleontology, comparative anatomy, embryology and molecular evidences); Darwin’s contribution, modern synthetic theory of evolution; mechanism of evolution – variation (mutation and recombination) and natural selection with examples, types of natural selection; Gene flow and genetic drift; Hardy – Weinberg’s principle; adaptive radiation; human evolution.

Chapter-8: Human Health and Diseases
Pathogens; parasites causing human diseases (malaria, dengue, chickengunia, filariasis, ascariasis, typhoid, pneumonia, common cold, amoebiasis, ring worm) and their control; Basic concepts of immunology – vaccines; cancer, HIV and AIDS; Adolescence – drug and alcohol abuse.

Chapter-9: Strategies for Enhancement in Food Production
Improvement in food production: Plant breeding, tissue culture, single cell protein, Biofortification, Apiculture and Animal husbandry.

Main Points for Chapter 10, 11, 12

Chapter-10: Microbes in Human Welfare
In household food processing, industrial production, sewage treatment, energy generation and microbes as biocontrol agents and biofertilizers. Antibiotics; production and judicious use.

Chapter-11: Biotechnology – Principles and processes
Genetic Engineering (Recombinant DNA Technology).

Chapter-12: Biotechnology and its Application
Application of biotechnology in health and agriculture: Human insulin and vaccine production, stem cell technology, gene therapy; genetically modified organisms – Bt crops; transgenic animals; biosafety issues, bio piracy and patents.

Main Points for Chapter 13, 14

Chapter-13: Organisms and Populations
Organisms and environment: Habitat and niche, population and ecological adaptations; population interactions – mutualism, competition, predation, parasitism; population attributes – growth, birth rate and death rate, age distribution.

Chapter-14: Ecosystem
Ecosystems: Patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass, energy; nutrient cycles (carbon and phosphorous); ecological succession; ecological services – carbon fixation, pollination, seed dispersal, oxygen release (in brief).

Main Points for Chapter 15, 16

Chapter-15: Biodiversity and its Conservation
Concept of biodiversity; patterns of biodiversity; importance of biodiversity; loss of biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data Book, biosphere reserves, national parks, sanctuaries and Ramsar sites.

Chapter-16: Environmental Issues
Air pollution and its control; water pollution and its control; agrochemicals and their effects; solid waste management; radioactive waste management; greenhouse effect and climate change; ozone layer depletion; deforestation; any one case study as success story addressing environmental issue(s).

Important Questions on 12th Biology

Offspring formed due to sexual reproduction have better chances of survival. Why? Is this statement always true?
Sexual reproduction involves the fusion of the male and the female gamete. This fusion allows the formation of new variants by the combination of the DNA from two (usually) different members of the species. The variations allow the individuals to adapt under varied environmental conditions for better chances of survival. However, it is not always necessary that the offspring produced due to sexual reproduction has better chances of survival. Under some circumstances, asexual reproduction is more advantageous for certain organisms. For example, some individuals who do not move from one place to another and are well settled in their environment. Also, asexual reproduction is a fast and a quick mode of reproduction which does not consume much time and energy as compared to sexual reproduction.
What are chasmogamous flowers? Can cross-pollination occur in cleistogamous flowers? Give reasons for your answer.
There are two types of flowers present in plants namely Oxalis and Viola − chasmogamous and cleistogamous flowers.
Chasmogamous flowers have exposed anthers and stigmata similar to the flowers of other species.
Cross-pollination cannot occur in cleistogamous flowers. This is because cleistogamous flowers never open at all. Also, the anther and the stigma lie close to each other in these flowers. Hence, only self-pollination is possible in these flowers.
Define spermiogenesis and spermiation.
Spermiogenesis
It is the process of transforming spermatids into matured spermatozoa or sperms.

Spermiation
It is the process when mature spermatozoa are released from the sertoli cells into the lumen of seminiferous tubules.

What are the suggested reasons for population explosion?
The human population is increasing day by day, leading to population explosion. It is because of the following two major reasons.

Decreased death rate
Increased birth rate and longevity

The death rate has decreased in the past 50 years. The factor leading to decreased death rate and increased birth rate are control of diseases, awareness and spread of education, improvement in medical facilities, ensured food supply in emergency situation, etc. All this has also resulted in an increase in the longevity of an individual.

What is pedigree analysis? Suggest how such an analysis, can be useful.
Pedigree analysis is a record of occurrence of a trait in several generations of a family. It is based on the fact that certain characteristic features are heritable in a family, for example, eye colour, skin colour, hair form and colour, and other facial characteristics. Along with these features, there are other genetic disorders such as Mendelian disorders that are inherited in a family, generation after generation. Hence, by using pedigree analysis for the study of specific traits or disorders, generation after generation, it is possible to trace the pattern of inheritance. In this analysis, the inheritance of a trait is represented as a tree, called family tree. Genetic counselors use pedigree chart for analysis of various traits and diseases in a family and predict their inheritance patterns. It is useful in preventing hemophilia, sickle cell anemia, and other genetic disorders in the future generations.
If the sequence of one strand of DNA is written as follows: 5′-ATGCATGCATGCATGCATGCATGCATGC-3′ Write down the sequence of complementary strand in 5’→3′ direction.
The DNA strands are complementary to each other with respect to base sequence.
Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in 5′ to 3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in 5′ to 3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT− 3’

Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.
Fossils of dinosaurs have revealed the evolution of reptiles in Jurassic period. As a result of this, evolution of other animals such as birds and mammals has also been discovered. However, two unusual fossils recently unearthed in China have ignited a controversy over the evolution of birds. Confuciusornis is one such genus of primitive birds that were crow sized and lived during the Creataceous period in China.
Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
A ‘suitable gene’ refers to a specific DNA segment which can be injected into the cells of the host body to produce specific proteins. This protein kills the specific disease causing organism in the host body and provides immunity.
If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production?
Dairy farm management deals with processes which aim at improving the quality and quantity of milk production. Milk production is primarily dependent on choosing improved cattle breeds, provision of proper feed for cattle, maintaining proper shelter facilities, and regular cleaning of cattle.
Choosing improved cattle breeds is an important factor of cattle management. Hybrid cattle breeds are produced for improved productivity. Therefore, it is essential that hybrid cattle breeds should have a combination of various desirable genes such as high milk production and high resistance to diseases. Cattle should also be given healthy and nutritious food consisting of roughage, fibre concentrates, and high levels of proteins and other nutrients.
Cattle’s should be housed in proper cattle-houses and should be kept in well ventilated roofs to prevent them from harsh weather conditions such as heat, cold, and rain. Regular baths and proper brushing should be ensured to control diseases. Also, time-to-time check-ups by a veterinary doctor for symptoms of various diseases should be undertaken.
Bacteria cannot be seen with the naked eyes, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why?
Curd can be used as a sample for the study of microbes. Curd contains numerous lactic acid bacteria (LAB) or Lactobacillus. These bacteria produce acids that coagulate and digest milk proteins. A small drop of curd contains millions of bacteria, which can be easily observed under a microscope.
Do eukaryotic cells have restriction endonucleases? Justify your answer.
No, eukaryotic cells do not have restriction endonucleases. This is because the DNA of eukaryotes is highly methylated by a modification enzyme, called methylase. Methylation protects the DNA from the activity of restriction enzymes .These enzymes are present in prokaryotic cells where they help prevent the invasion of DNA by virus.
What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency.
Gene therapy is a technique for correcting a defective gene through gene manipulation. It involves the delivery of a normal gene into the individual to replace the defective gene, for example, the introduction of gene for adenosine deaminase (ADA) in ADA deficient individual. The adenosine deaminase enzyme is important for the normal functioning of the immune system. The individual suffering from this disorder can be cured by transplantation of bone marrow cells. The first step involves the extraction of lymphocyte from the patient’s bone marrow. Then, a functional gene for ADA is introduced into lymphocytes with the help of retrovirus. These treated lymphocytes containing ADA gene are then introduced into the patient’s bone marrow. Thus, the gene gets activated producing functional T- lymphocytes and activating the patient’s immune system.
Define phenotypic adaptation. Give one example.
Phenotypic adaptation involves changes in the body of an organism in response to genetic mutation or certain environmental changes. These responsive adjustments occur in an organism in order to cope with environmental conditions present in their natural habitats. For example, desert plants have thick cuticles and sunken stomata on the surface of their leaves to prevent transpiration. Similarly, elephants have long ears that act as thermoregulators.
What is primary productivity? Give brief description of factors that affect primary productivity.
It is defined as the amount of organic matter or biomass produced by producers per unit area over a period of time.
Primary productivity of an ecosystem depends on the variety of environmental factors such as light, temperature, water, precipitation, etc. It also depends on the availability of nutrients and the availability of plants to carry out photosynthesis.
How do ecologists estimate the total number of species present in the world?
The diversity of living organisms present on the Earth is very vast. According to an estimate by researchers, it is about seven millions.
The total number of species present in the world is calculated by ecologists by statistical comparison between a species richness of a well-studied group of insects of temperate and tropical regions. Then, these ratios are extrapolated with other groups of plants and animals to calculate the total species richness present on the Earth.
Write critical notes on Eutrophication.
Eutrophication: It is the natural ageing process of a lake caused due to nutrient enrichment. It is brought down by the runoff of nutrients such as animal wastes, fertilizers, and sewage from land which leads to an increased fertility of the lake. As a result, it causes a tremendous increase in the primary productivity of the ecosystem. This leads to an increased growth of algae, resulting into algal blooms. Later, the decomposition of these algae depletes the supply of oxygen, leading to the death of other aquatic animal life.