NCERT Solutions for Class 12 Biology
NCERT Solutions for Class 12 Biology in PDF form to free download updated for new academic session 2020-21 for UP Board, CBSE, MP Board and all other boards who are following CBSE Syllabus 2020-2021.
All the NCERT solutions 2020-21 and NCERT books are given to download chapter wise. Download Supplementary material for class 12 Biology in PDF form. Join the Discussion forum and ask your doubts.NCERT Solutions for Class 12 Biology
Class: | 12 |
Subject: | Biology |
Contents: | NCERT Solutions |
NCERT Solutions for Class 12 Biology in English
NCERT Solutions for Class 12 Biology all chapters are given below. NCERT Solutions 2020-21 for other subjects Physics, Chemistry, Maths are also available to download. Download sample papers and Previous Years CBSE board papers as per latest CBSE Syllabus for 2020-2021 for more practice of subjects. Download all chapters in PDF format available in NCERT solutions sections of each subject.
Select the Chapter for 12th Biology Solutions
- Chapter 1: Reproduction in Organisms
- Chapter 2: Sexual Reproduction in Flowering Plants
- Chapter 3: Human Reproduction
- Chapter 4: Reproductive Health
- Chapter 5: Principle of Inheritance and Variation
- Chapter 6: Molecular Basis of Inheritance
- Chapter 7: Evolution
- Chapter 8: Human Health and Diseases
- Chapter 9: Strategies for Enhancement in Food Production
- Chapter 10: Microbes in Human Welfare
- Chapter 11: Biotechnology: Principles and Processes
- Chapter 12: Biotechnology and its Applications
- Chapter 13: Organisms and Populations
- Chapter 14: Ecosystem
- Chapter 15: Biodiversity and Conservation
- Chapter 16: Environmental Issues
Main Points for Chapter 1, 2, 3
Chapter-1: Reproduction in Organisms
Reproduction, a characteristic feature of all organisms for continuation of species; modes of reproduction – asexual and sexual reproduction; asexual reproduction – binary fission, sporulation, budding, gemmule formation, fragmentation; vegetative propagation in plants.
Chapter-2: Sexual Reproduction in Flowering Plants
Flower structure; development of male and female gametophytes; pollination – types, agencies and examples; outbreeding devices; pollen-pistil interaction; double fertilization; post fertilization events – development of endosperm and embryo, development of seed and formation of fruit; special modes-apomixis, parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.
Chapter-3: Human Reproduction
Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis – spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development upto blastocyst formation, implantation; pregnancy and placenta formation (elementary idea); parturition (elementary idea); lactation (elementary idea).
Main Points for Chapter 4, 5, 6
Chapter-4: Reproductive Health
Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth control – need and methods, contraception and medical termination of pregnancy (MTP); amniocentesis; infertility and assisted reproductive technologies – IVF, ZIFT, GIFT (elementary idea for general awareness).
Chapter-5: Principles of Inheritance and Variation
Heredity and variation: Mendelian inheritance; deviations from Mendelism – incomplete dominance, co-dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic inheritance; chromosome theory of inheritance; chromosomes and genes; Sex determination – in humans, birds and honey bee; linkage and crossing over; sex linked inheritance – haemophilia, colour blindness; Mendelian disorders in humans – thalassemia; chromosomal disorders in humans; Down’s syndrome, Turner’s and Klinefelter’s syndromes.
Chapter-6: Molecular Basis of Inheritance
Search for genetic material and DNA as genetic material; Structure of DNA and RNA; DNA packaging; DNA replication; Central dogma; transcription, genetic code, translation; gene expression and regulation – lac operon; genome and human and rice genome projects; DNA fingerprinting.
Main Points for Chapter 7, 8, 9
Chapter-7: Evolution
Origin of life; biological evolution and evidences for biological evolution (paleontology, comparative anatomy, embryology and molecular evidences); Darwin’s contribution, modern synthetic theory of evolution; mechanism of evolution – variation (mutation and recombination) and natural selection with examples, types of natural selection; Gene flow and genetic drift; Hardy – Weinberg’s principle; adaptive radiation; human evolution.
Chapter-8: Human Health and Diseases
Pathogens; parasites causing human diseases (malaria, dengue, chickengunia, filariasis, ascariasis, typhoid, pneumonia, common cold, amoebiasis, ring worm) and their control; Basic concepts of immunology – vaccines; cancer, HIV and AIDS; Adolescence – drug and alcohol abuse.
Chapter-9: Strategies for Enhancement in Food Production
Improvement in food production: Plant breeding, tissue culture, single cell protein, Biofortification, Apiculture and Animal husbandry.
Main Points for Chapter 10, 11, 12
Chapter-10: Microbes in Human Welfare
In household food processing, industrial production, sewage treatment, energy generation and microbes as biocontrol agents and biofertilizers. Antibiotics; production and judicious use.
Chapter-11: Biotechnology – Principles and processes
Genetic Engineering (Recombinant DNA Technology).
Chapter-12: Biotechnology and its Application
Application of biotechnology in health and agriculture: Human insulin and vaccine production, stem cell technology, gene therapy; genetically modified organisms – Bt crops; transgenic animals; biosafety issues, bio piracy and patents.
Main Points for Chapter 13, 14
Chapter-13: Organisms and Populations
Organisms and environment: Habitat and niche, population and ecological adaptations; population interactions – mutualism, competition, predation, parasitism; population attributes – growth, birth rate and death rate, age distribution.
Chapter-14: Ecosystem
Ecosystems: Patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass, energy; nutrient cycles (carbon and phosphorous); ecological succession; ecological services – carbon fixation, pollination, seed dispersal, oxygen release (in brief).
Main Points for Chapter 15, 16
Chapter-15: Biodiversity and its Conservation
Concept of biodiversity; patterns of biodiversity; importance of biodiversity; loss of biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data Book, biosphere reserves, national parks, sanctuaries and Ramsar sites.
Chapter-16: Environmental Issues
Air pollution and its control; water pollution and its control; agrochemicals and their effects; solid waste management; radioactive waste management; greenhouse effect and climate change; ozone layer depletion; deforestation; any one case study as success story addressing environmental issue(s).
Important Questions on 12th Biology
Chasmogamous flowers have exposed anthers and stigmata similar to the flowers of other species.
Cross-pollination cannot occur in cleistogamous flowers. This is because cleistogamous flowers never open at all. Also, the anther and the stigma lie close to each other in these flowers. Hence, only self-pollination is possible in these flowers.
It is the process of transforming spermatids into matured spermatozoa or sperms.
Spermiation
It is the process when mature spermatozoa are released from the sertoli cells into the lumen of seminiferous tubules.
Decreased death rate
Increased birth rate and longevity
The death rate has decreased in the past 50 years. The factor leading to decreased death rate and increased birth rate are control of diseases, awareness and spread of education, improvement in medical facilities, ensured food supply in emergency situation, etc. All this has also resulted in an increase in the longevity of an individual.
Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5′ to 3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5′ to 3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT− 3’
Choosing improved cattle breeds is an important factor of cattle management. Hybrid cattle breeds are produced for improved productivity. Therefore, it is essential that hybrid cattle breeds should have a combination of various desirable genes such as high milk production and high resistance to diseases. Cattle should also be given healthy and nutritious food consisting of roughage, fibre concentrates, and high levels of proteins and other nutrients.
Cattle’s should be housed in proper cattle-houses and should be kept in well ventilated roofs to prevent them from harsh weather conditions such as heat, cold, and rain. Regular baths and proper brushing should be ensured to control diseases. Also, time-to-time check-ups by a veterinary doctor for symptoms of various diseases should be undertaken.
Primary productivity of an ecosystem depends on the variety of environmental factors such as light, temperature, water, precipitation, etc. It also depends on the availability of nutrients and the availability of plants to carry out photosynthesis.
The total number of species present in the world is calculated by ecologists by statistical comparison between a species richness of a well-studied group of insects of temperate and tropical regions. Then, these ratios are extrapolated with other groups of plants and animals to calculate the total species richness present on the Earth.